The details of the biochemistry of DNA, RNA and many related molecules have grown to such a large amount of information that we often forget to consider the simple pathways of these chemicals of life. The means by which DNA copies itself (replicates) and passes genetic information to the next generation (transcription) are beautiful in their simplicity. There is a tendency on the part of the neophyte biology student to be dazzled by the seemingly complex array of compounds, enzymes, and structures used to carry out these processes. Yet the building blocks of life remain basic in their nature.
The details of the biochemistry of DNA, RNA and many related molecules have grown to such a large amount of information that we often forget to consider the simple pathways of these chemicals of life. The means by which DNA copies itself (replicates) and passes genetic information to the next generation (transcription) are beautiful in their simplicity. There is a tendency on the part of the neophyte biology student to be dazzled by the seemingly complex array of compounds, enzymes, and structures used to carry out these processes. Yet the building blocks of life remain basic in their nature.
Let's begin with some definitions and construct a description of the genetic machine. DNA is DEOXYRIBOSE NUCLEIC ACID. Ribose is a common five carbon sugar. The backbone of a single strand of DNA is a long chain of alternating sugars (deoxyribose) and phosphate groups.
SUGAR - PHOSPHATE - SUGAR - PHOSPHATE - SUGAR - PHOSPHATE -
Attached to each and every deoxyribose (sugar) is one of four specific nucleotides. Cytosine and Thymine are called pyrimidines. Adenine and Guanine are called purines. The four compounds Cytosine, Thymine, Adenine and Guanine are the only ones used as attachments to the DNA backbone. These four nucleotide compounds are usually abbreviated by their first letters only. Thus, Cytosine is C and Thymine is T, etc. A single DNA strand has this form:
SUGAR - PHOSPHATE - SUGAR - PHOSPHATE - SUGAR - PHOSPHATE -
| | |
C G T
and goes on in length for many millions of groups of these four nucleotide compounds. This is a single strand of DNA. However, DNA is usually not found as a single-stranded molecule. It normally has two complimentary strands wrapped around each other in the form of a spiral, or helix. Hence, the name "double-helix."
An interesting feature of the purines and pyrimidines is that they bind together in unique pairs. Adenine always binds with Thymine (abbreviated as A-T) and Cytosine always binds with Guanine (C-G.) So whenever we say that the two strands of DNA are complimentary, we mean that all of the C(s) are bound to G(s) in pairs and all of the A(s) are bound to all of the T(s) in pairs. A section of a complete DNA molecule may be written like this:
SUGAR - PHOSPHATE - SUGAR - PHOSPHATE - SUGAR - PHOSPHATE -
| | |
C G T
G C A
| | |
SUGAR - PHOSPHATE - SUGAR - PHOSPHATE - SUGAR - PHOSPHATE -
Note how the C and G line up along the backbone structure. And note how the A and T also line up along the backbone structure. Each C-G, G-C, TA and AT is know as a base pair. The alignment and sequence of base pairs represent "letters" of the genetic alphabet (also called the genetic code) which together determine each and every one of the chemical characteristics of the organism which they will produce. In order to save space, a section of the DNA is written by typing only the base pairs, ignoring the deoxyribose and phosphate backbone completely. A very short section of a DNA molecule may be written like this:1
CGTCCAGTATTGCGCGTGATCACTCGAATGCTAACCACACAACTTGTA
GCAGGTCATAACGCGCACTAGTGAGCTTACGATTGGTGTGTTGAACAT
Within a living cell long strands of DNA are wound around structures called histones. Histones seem to support the structure of the DNA. The DNA and the histones are bundled into structures called chromosomes. As you can imagine, the DNA within the chromosomes is tightly wound and condensed. During replication (DNA making a replica of itself) portions of the DNA strands unwind a little bit. The untwisted portions of the DNA almost straighten out allowing the base pairs to be exposed to the fluids and chemicals within the cell. Sometimes the amount of unraveling is so large that structures called 'puffs' can be seen. These puffs are presumed to be the regions where the tightly wound DNA has loosened to permit replication or transcription. The individual strands of DNA separate, unpairing the nucleotide base-pairs, unzipping almost like a common zipper does. While the nucleotides are exposed they are joined by other complimentary nucleotides (C's to G's and T's to A's) forming two new strings. These new strings (one on each old string) each form a new deoxyribose-phosphate backbone. The process continues with the original DNA continuing to unravel and replicate until the entire DNA molecule has formed two identical DNA molecules. Each of these new (daughter DNA) molecules contains one strand from the original DNA molecule and one newly made strand.
DNA --> (replication) --> Daughter DNA
Daughter DNA
As it unravels, DNA also undergoes another process called transcription. Transcription uses a single strand of the DNA as a template for the production of RNA. RNA is RIBOSE NUCLEIC ACID. Although the structure of RNA is very similar to the structure of a single strand of DNA, RNA is not a double helix. RNA has only one strand or chain of a ribose-phosphate backbone. RNA utilizes the sugar ribose while DNA utilizes the sugar deoxyribose. Another difference between RNA and DNA is that RNA substitutes the pyrimidine called Uracil for Thymine. Every location on the original DNA strand that holds an Adenine will form a location on a piece of RNA with a Uracil molecule. Here is a sample of a segment of a single strand of DNA as it is used as a template to produce a strand of RNA:
DNA(single strand) = CGTCCAGTATTGCGCGTGATCACTCG...
RNA = GCAGGUCAUAACGCGCACUAGUGAGC...
Some sections of DNA code for messenger RNA (mRNA). mRNA carries the instructions for producing complex long chain protein molecules from simple amino acids. Some sections of DNA code for ribosomal RNA (rRNA.) rRNA are large molecules that form structures called ribosomes. Ribosomes are special tools or factories where amino acids are assembled into proteins using the codes on a single strand of mRNA. Some sections of DNA code for transfer RNA (tRNA). tRNA molecules carry specific amino acid molecules from the free fluid environment within the cell to the site of protein synthesis within a ribosome.
DNA --> (transcription) --> RNA (mRNA rRNA tRNA)
Once the single strand of the DNA has been used as a template to make some RNA, the DNA strand goes back to join its complimentary strand, reforming a double helix of that portion of the DNA molecule.
rRNA as far as we can tell comes in four separate molecules. Each one is considered rRNA. These four rRNA subunits come together to form a structure called a ribosome. Ribosomes are the manufacturing sites for the production of proteins. Once a ribosome is formed, it finds a strand of mRNA and begins the business of synthesizing proteins.
mRNA carries the sequences of nucleotides used to make proteins from amino acids. The strand of mRNA is threaded through the ribosome almost as a thread is drawn through the eye of a needle. As the mRNA is slowly drawn through the ribosome, each sequence of three nucleotides represents the code for a specific amino acid. A single molecule of tRNA is used to transport that particular amino acid to the site of the ribosome. The tRNA brings the amino acid to the ribosome. The mRNA and the ribosome hold that amino acid in place while the next sequence of three nucleotides call for another amino acid. The next amino acid is brought into place and joined to the first. This process continues until the whole mRNA has passed through the ribosome and a long string of amino acids have been fused into a protein. This process of protein synthesis is called translation. In a manner of speaking, the language of the mRNA is translated into a protein.
mRNA --> (translation) --> Proteins
This protein production is what we think of when we speak of "life." The many proteins produced by our DNA through its subsequent mRNA(s) form the basis of our bodies. Almost all of the components of our bodies are built by the action and interaction of protein compounds. Protein synthesis (production) may be simplified as follows: individual units of rRNA bind together to form ribosomes which can be thought of as factories for protein production. The physical shape of these ribosomes permits a single strand of mRNA to enter one end of the ribosome. Once the mRNA is locked in place, tRNA begins to carry amino acids (simple proteins) to the site. The code on the mRNA (i.e. its specific sequence of bases) specifies which amino acid and tRNA is to be accepted. All others are blocked from entering until it is their turn. A variety of enzymes (special proteins) and co-factors begin attaching the tRNA and its amino acid to the mRNA. After the first amino acid is fixed in place the entire mRNA molecule is moved along through the ribosome. This movement exposes the next code to specify the next amino acid. The second specific amino acid-tRNA complex is brought into position. The two amino acids are fused together and the process repeats itself from the beginning. After every step along the mRNA has been taken a newly synthesized protein emerges from the ribosome while the original mRNA also emerges; free to begin the production of another similar protein molecule.
By way of review, we have
DNA --> (replication) --> Daughter DNA
Daughter DNA
|
(transcription) |
tRNA (carries amino acids (AA))
Proteins <--- (translation) <--- mRNA (specifies the sequence of AA) rRNA (holds the tRNA and mRNA)
(1) Note how each G is paired with a C and each A with a T (and vice versa).